IL4 cloning plasmid

Our suppliers Contact us

Product description:

Price: 233.00

Size: 10ug

Catalog no: CSB-CL011659HU-10ug

Details:

Notes

For research use only.

Description

A cloning plasmid for the IL4 gene.

Specifications

Gene name: IL4; Gene ID: 3565; Accession number: BC067514; Vector: pENTR223.1

Storage_and_shipping

Transported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.

Additional_information

Formulation: 10 μg plasmid + 200μl Glycerol; Length: 462; Sequence: atgggtctcacctcccaactgcttccccctctgttcttcctgctagcatgtgccggcaactttgtccacggacacaagtgcgatatcaccttacaggagatcatcaaaactttgaacagcctcacagagcagaagactctgtgcaccgagttgaccgtaacagacatctttgctgcctccaagaacacaactgagaaggaaaccttctgcagggctgcgactgtgctccggcagttctacagccaccatgagaaggacactcgctgcctgggtgcgactgcacagcagttccacaggcacaagcagctgatccgattcctgaaacggctcgacaggaacctctggggcctggcgggcttgaattcctgtcctgtgaaggaagccaaccagagtacgttggaaaacttcttggaaaggctaaagacgatcatgagagagaaatattcaaagtgttcgagctga

Gene

Interleukin 4 (IL4) is a cytokine that induces differentiation of naive helper T cells (Th0 cells) to Th2 cells. It is used for dendritic and T cell therapy. Upon activation by IL-4, Th2 cells subsequently produce additional IL-4 in a positive feedback loop. The cell that initially produces IL-4, thus inducing Th0 differentiation, has not been identified, but recent studies suggest that basophils may be the effector cell. It is closely related and has functions similar to Interleukin 13. Recombinant, GMP rec. E. coli interleukin-4 for cell culture supplied by GENTAUR. Free samples on request.

Kit

Plasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.